Skip to content

Honour user-defined codon frequencies (+FU) for GY-type models #210

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Merged
bqminh merged 1 commit into from
Sep 9, 2026
Merged

Honour user-defined codon frequencies (+FU) for GY-type models #210

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
6 changes: 5 additions & 1 deletion model/modelcodon.cpp
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -393,7 +393,11 @@ void ModelCodon::init(const char *model_name, string model_params, StateFreqType
size_t pos;
if ((pos=name.find('_')) == string::npos) {
def_freq = initCodon(model_name, freq, true, freq_params);
if (freq == FREQ_USER_DEFINED && def_freq != FREQ_USER_DEFINED) // mechanistic model
// A mechanistic model with nucleotide-targeted frequencies (MG-style,
// CF_TARGET_NT) cannot take user-defined codon frequencies: keep the
// frequency type the model chose (F3X4). A codon-targeted model
// (GY-style) can, so a +FU{...} request is honoured (issue #192).
if (freq == FREQ_USER_DEFINED && def_freq != FREQ_USER_DEFINED && codon_freq_style == CF_TARGET_NT)
freq = def_freq;
} else {
def_freq = initCodon(name.substr(0, pos).c_str(), freq, false, freq_params);
Expand Down
8 changes: 8 additions & 0 deletions test_scripts/test_data/codon.fa
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,8 @@
>A
CTAAATACCTATCAAGGCTATATCAAGAATTCTAACTTTGGCGATATCCTGACACTCTGGCCTATCACCGATACAATCCGTAAGGAATACCTCAAGTACGACGGAACTCAGGGTTTTAGCGCTTCTAAAGTGAATTTACCAGCTTTCGCGTTTAACATCAACGTCGGCGAGCAGGTTGCC
>B
CTAGAAACCTATCAAGGCAACATCAAGAATTCTAACTTTGGCGATATCCTGACACGCTGGGTTATCACCAAGACAATCCGTAAGGAATACTTGAAGCAAGAAGGAACTCAGGTATTTAGCGCTTCTTGTGTGACGTTAATGGCTTTCGCGGAACCTATCCCGGTCGGCGAGCAGGTTGTA
>C
CTAAATACCTATCAAGGCAACATCAAGAATTCTAAGTTTGGCGATATCCTGACACCGTGGTTGATCTTGTTAACAATGCGTAAGCAGTACCTCAAGATTGAAACAGTCCAGTGCATTAATGCTTCTTGTGCAAATTTACCAGCTTTCGTAGAACCTATCACCCGAGGCTTCCAGGTTGCC
>D
CTAAATACCTATCAAGGCAACATCGTGAATTCTAACTTTTACGATATCCTGACACTCTGGGTTATCATCTCGACAATCCGTAAGGAAGCTCTCAAGTACGAAACACCGGTCGGGTGCAGCGCTTCTTGTGTGAATTTACCAGCTTTCGCGGAACCTATCAACGTCGGCGAGCAGGTTGCC
1 change: 1 addition & 0 deletions test_scripts/test_data/codon.tree
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1 @@
((A:0.1,B:0.1):0.05,(C:0.1,D:0.1):0.05);
1 change: 1 addition & 0 deletions test_scripts/test_data/codon_freq.txt
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1 @@
0.006730,0.006889,0.024338,0.011576,0.013103,0.018368,0.020609,0.004870,0.012589,0.014976,0.016145,0.009653,0.018481,0.027196,0.013910,0.017521,0.007513,0.011175,0.020372,0.007357,0.025591,0.026099,0.006989,0.026865,0.013517,0.022890,0.022535,0.011664,0.020618,0.020104,0.023682,0.010960,0.022461,0.027337,0.020546,0.017329,0.007375,0.016333,0.012997,0.021611,0.020680,0.018040,0.008991,0.019906,0.019558,0.008924,0.025656,0.020135,0.007606,0.026643,0.008036,0.012512,0.021667,0.018771,0.017770,0.019949,0.015482,0.012062,0.008860,0.006323,0.021558
2 changes: 2 additions & 0 deletions test_scripts/test_data/expect_ans.txt
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -8,6 +8,8 @@ turtle.mix.link.iqtree Log-likelihood of the tree -5625.6391 1
turtle.mixfinder.iqtree Log-likelihood of the tree -5332.2489 1
turtle.nex.outgroup.iqtree Log-likelihood of the tree -5352.2653 1
turtle.lmap.outgroup.iqtree Log-likelihood of the tree -5377.9500 1
codon.gy.fu.iqtree Log-likelihood of the tree -674.5579 1
codon.gy.f3x4.iqtree Log-likelihood of the tree -665.0301 1
turtle.nex.constr.iqtree Log-likelihood of the tree -5360.0758 1
turtle.nex.constr2.iqtree Log-likelihood of the tree -5360.0758 1
turtle.nex.iqtree Log-likelihood of the tree -5360.0759 1
Expand Down
5 changes: 5 additions & 0 deletions test_scripts/test_iqtree.ps1
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -100,6 +100,11 @@ Measure-IQTree "$IQTreeBin -s $WD/turtle.fa -m `"MIX+MF`" --prefix $OutDir/turtl
Measure-IQTree "$IQTreeBin -s $WD/turtle.fa -p $WD/turtle.nex -o phrynops -m GTR+G --prefix $OutDir/turtle.nex.outgroup -T 1 -seed $SEED"
Measure-IQTree "$IQTreeBin -s $WD/turtle.fa -lmap 100 -o phrynops -m GTR+G --prefix $OutDir/turtle.lmap.outgroup -T 1 -seed $SEED"

# user-defined codon frequencies must be honoured by GY-type models (issue #192)
$CodonFreq = (Get-Content $WD/codon_freq.txt -Raw).Trim()
Measure-IQTree "$IQTreeBin -s $WD/codon.fa -st CODON -te $WD/codon.tree -blfix -m `"GY{0.8,1.07}+FU{$CodonFreq}`" --prefix $OutDir/codon.gy.fu -T 1 -seed $SEED"
Measure-IQTree "$IQTreeBin -s $WD/codon.fa -st CODON -te $WD/codon.tree -blfix -m `"GY{0.8,1.07}+F3X4`" --prefix $OutDir/codon.gy.f3x4 -T 1 -seed $SEED"

## amino acid test cases
Write-Host "Running amino acid test cases..."

Expand Down
6 changes: 6 additions & 0 deletions test_scripts/test_iqtree.sh
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -92,6 +92,12 @@ run_timed ${IQTREE_BIN} -s ${WD}/turtle.fa -p ${WD}/turtle.nex -o phrynops -m GT

run_timed ${IQTREE_BIN} -s ${WD}/turtle.fa -lmap 100 -o phrynops -m GTR+G --prefix ${OUT_DIR}/turtle.lmap.outgroup -T 1 -seed $SEED

# user-defined codon frequencies must be honoured by GY-type models (issue #192)

run_timed ${IQTREE_BIN} -s ${WD}/codon.fa -st CODON -te ${WD}/codon.tree -blfix -m "GY{0.8,1.07}+FU{$(cat ${WD}/codon_freq.txt)}" --prefix ${OUT_DIR}/codon.gy.fu -T 1 -seed $SEED

run_timed ${IQTREE_BIN} -s ${WD}/codon.fa -st CODON -te ${WD}/codon.tree -blfix -m "GY{0.8,1.07}+F3X4" --prefix ${OUT_DIR}/codon.gy.f3x4 -T 1 -seed $SEED


## amino acid test cases
echo "Running amino acid test cases..."
Expand Down
Loading