diff --git a/model/modelcodon.cpp b/model/modelcodon.cpp
index 8c7df792..8c33a136 100644
--- a/model/modelcodon.cpp
+++ b/model/modelcodon.cpp
@@ -393,7 +393,11 @@ void ModelCodon::init(const char *model_name, string model_params, StateFreqType
     size_t pos;
 	if ((pos=name.find('_')) == string::npos) {
 		def_freq = initCodon(model_name, freq, true, freq_params);
-        if (freq == FREQ_USER_DEFINED && def_freq != FREQ_USER_DEFINED) // mechanistic model
+        // A mechanistic model with nucleotide-targeted frequencies (MG-style,
+        // CF_TARGET_NT) cannot take user-defined codon frequencies: keep the
+        // frequency type the model chose (F3X4). A codon-targeted model
+        // (GY-style) can, so a +FU{...} request is honoured (issue #192).
+        if (freq == FREQ_USER_DEFINED && def_freq != FREQ_USER_DEFINED && codon_freq_style == CF_TARGET_NT)
             freq = def_freq;
 	} else {
 		def_freq = initCodon(name.substr(0, pos).c_str(), freq, false, freq_params);
diff --git a/test_scripts/test_data/codon.fa b/test_scripts/test_data/codon.fa
new file mode 100644
index 00000000..1fc21ad6
--- /dev/null
+++ b/test_scripts/test_data/codon.fa
@@ -0,0 +1,8 @@
+>A
+CTAAATACCTATCAAGGCTATATCAAGAATTCTAACTTTGGCGATATCCTGACACTCTGGCCTATCACCGATACAATCCGTAAGGAATACCTCAAGTACGACGGAACTCAGGGTTTTAGCGCTTCTAAAGTGAATTTACCAGCTTTCGCGTTTAACATCAACGTCGGCGAGCAGGTTGCC
+>B
+CTAGAAACCTATCAAGGCAACATCAAGAATTCTAACTTTGGCGATATCCTGACACGCTGGGTTATCACCAAGACAATCCGTAAGGAATACTTGAAGCAAGAAGGAACTCAGGTATTTAGCGCTTCTTGTGTGACGTTAATGGCTTTCGCGGAACCTATCCCGGTCGGCGAGCAGGTTGTA
+>C
+CTAAATACCTATCAAGGCAACATCAAGAATTCTAAGTTTGGCGATATCCTGACACCGTGGTTGATCTTGTTAACAATGCGTAAGCAGTACCTCAAGATTGAAACAGTCCAGTGCATTAATGCTTCTTGTGCAAATTTACCAGCTTTCGTAGAACCTATCACCCGAGGCTTCCAGGTTGCC
+>D
+CTAAATACCTATCAAGGCAACATCGTGAATTCTAACTTTTACGATATCCTGACACTCTGGGTTATCATCTCGACAATCCGTAAGGAAGCTCTCAAGTACGAAACACCGGTCGGGTGCAGCGCTTCTTGTGTGAATTTACCAGCTTTCGCGGAACCTATCAACGTCGGCGAGCAGGTTGCC
diff --git a/test_scripts/test_data/codon.tree b/test_scripts/test_data/codon.tree
new file mode 100644
index 00000000..61730ff5
--- /dev/null
+++ b/test_scripts/test_data/codon.tree
@@ -0,0 +1 @@
+((A:0.1,B:0.1):0.05,(C:0.1,D:0.1):0.05);
diff --git a/test_scripts/test_data/codon_freq.txt b/test_scripts/test_data/codon_freq.txt
new file mode 100644
index 00000000..1fcb15f2
--- /dev/null
+++ b/test_scripts/test_data/codon_freq.txt
@@ -0,0 +1 @@
+0.006730,0.006889,0.024338,0.011576,0.013103,0.018368,0.020609,0.004870,0.012589,0.014976,0.016145,0.009653,0.018481,0.027196,0.013910,0.017521,0.007513,0.011175,0.020372,0.007357,0.025591,0.026099,0.006989,0.026865,0.013517,0.022890,0.022535,0.011664,0.020618,0.020104,0.023682,0.010960,0.022461,0.027337,0.020546,0.017329,0.007375,0.016333,0.012997,0.021611,0.020680,0.018040,0.008991,0.019906,0.019558,0.008924,0.025656,0.020135,0.007606,0.026643,0.008036,0.012512,0.021667,0.018771,0.017770,0.019949,0.015482,0.012062,0.008860,0.006323,0.021558
\ No newline at end of file
diff --git a/test_scripts/test_data/expect_ans.txt b/test_scripts/test_data/expect_ans.txt
index b373fcb8..277b12aa 100644
--- a/test_scripts/test_data/expect_ans.txt
+++ b/test_scripts/test_data/expect_ans.txt
@@ -8,6 +8,8 @@ turtle.mix.link.iqtree	Log-likelihood of the tree	-5625.6391	1
 turtle.mixfinder.iqtree	Log-likelihood of the tree	-5332.2489	1
 turtle.nex.outgroup.iqtree	Log-likelihood of the tree	-5352.2653	1
 turtle.lmap.outgroup.iqtree	Log-likelihood of the tree	-5377.9500	1
+codon.gy.fu.iqtree	Log-likelihood of the tree	-674.5579	1
+codon.gy.f3x4.iqtree	Log-likelihood of the tree	-665.0301	1
 turtle.nex.constr.iqtree	Log-likelihood of the tree	-5360.0758	1
 turtle.nex.constr2.iqtree	Log-likelihood of the tree	-5360.0758	1
 turtle.nex.iqtree	Log-likelihood of the tree	-5360.0759	1
diff --git a/test_scripts/test_iqtree.ps1 b/test_scripts/test_iqtree.ps1
index 24f1b1ec..d48ddde8 100755
--- a/test_scripts/test_iqtree.ps1
+++ b/test_scripts/test_iqtree.ps1
@@ -100,6 +100,11 @@ Measure-IQTree "$IQTreeBin -s $WD/turtle.fa -m `"MIX+MF`" --prefix $OutDir/turtl
 Measure-IQTree "$IQTreeBin -s $WD/turtle.fa -p $WD/turtle.nex -o phrynops -m GTR+G --prefix $OutDir/turtle.nex.outgroup -T 1 -seed $SEED"
 Measure-IQTree "$IQTreeBin -s $WD/turtle.fa -lmap 100 -o phrynops -m GTR+G --prefix $OutDir/turtle.lmap.outgroup -T 1 -seed $SEED"
 
+# user-defined codon frequencies must be honoured by GY-type models (issue #192)
+$CodonFreq = (Get-Content $WD/codon_freq.txt -Raw).Trim()
+Measure-IQTree "$IQTreeBin -s $WD/codon.fa -st CODON -te $WD/codon.tree -blfix -m `"GY{0.8,1.07}+FU{$CodonFreq}`" --prefix $OutDir/codon.gy.fu -T 1 -seed $SEED"
+Measure-IQTree "$IQTreeBin -s $WD/codon.fa -st CODON -te $WD/codon.tree -blfix -m `"GY{0.8,1.07}+F3X4`" --prefix $OutDir/codon.gy.f3x4 -T 1 -seed $SEED"
+
 ## amino acid test cases
 Write-Host "Running amino acid test cases..."
 
diff --git a/test_scripts/test_iqtree.sh b/test_scripts/test_iqtree.sh
index 95603b95..b2b24f7d 100755
--- a/test_scripts/test_iqtree.sh
+++ b/test_scripts/test_iqtree.sh
@@ -92,6 +92,12 @@ run_timed ${IQTREE_BIN} -s ${WD}/turtle.fa -p ${WD}/turtle.nex -o phrynops -m GT
 
 run_timed ${IQTREE_BIN} -s ${WD}/turtle.fa -lmap 100 -o phrynops -m GTR+G --prefix ${OUT_DIR}/turtle.lmap.outgroup -T 1 -seed $SEED
 
+# user-defined codon frequencies must be honoured by GY-type models (issue #192)
+
+run_timed ${IQTREE_BIN} -s ${WD}/codon.fa -st CODON -te ${WD}/codon.tree -blfix -m "GY{0.8,1.07}+FU{$(cat ${WD}/codon_freq.txt)}" --prefix ${OUT_DIR}/codon.gy.fu -T 1 -seed $SEED
+
+run_timed ${IQTREE_BIN} -s ${WD}/codon.fa -st CODON -te ${WD}/codon.tree -blfix -m "GY{0.8,1.07}+F3X4" --prefix ${OUT_DIR}/codon.gy.f3x4 -T 1 -seed $SEED
+
 
 ## amino acid test cases
 echo "Running amino acid test cases..."